ID: 1149737964_1149737967

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1149737964 1149737967
Species Human (GRCh38) Human (GRCh38)
Location 17:59014490-59014512 17:59014536-59014558
Sequence CCTAGGGGAGAGATAAACGTGTT AATTCCAACTATAAGTTTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 105} {0: 1, 1: 0, 2: 0, 3: 23, 4: 317}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!