ID: 1149739689_1149739700

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1149739689 1149739700
Species Human (GRCh38) Human (GRCh38)
Location 17:59033542-59033564 17:59033588-59033610
Sequence CCTGCCTCAGCCTCCCGTAGTGG ACCTGTATTTTCAGTAGATACGG
Strand - +
Off-target summary {0: 1, 1: 40, 2: 2401, 3: 76121, 4: 209094} {0: 1, 1: 1, 2: 27, 3: 571, 4: 15223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!