ID: 1149739689_1149739702

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1149739689 1149739702
Species Human (GRCh38) Human (GRCh38)
Location 17:59033542-59033564 17:59033589-59033611
Sequence CCTGCCTCAGCCTCCCGTAGTGG CCTGTATTTTCAGTAGATACGGG
Strand - +
Off-target summary {0: 1, 1: 40, 2: 2401, 3: 76121, 4: 209094} {0: 1, 1: 10, 2: 291, 3: 11705, 4: 190340}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!