ID: 1149760342_1149760344

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1149760342 1149760344
Species Human (GRCh38) Human (GRCh38)
Location 17:59223212-59223234 17:59223244-59223266
Sequence CCATTCATTATTTGTAAATGCGG TTATATATTTAAAGATGTAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 152} {0: 1, 1: 0, 2: 4, 3: 94, 4: 1048}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!