|
Left Crispr |
Right Crispr |
Crispr ID |
1149840507 |
1149840512 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
17:59960613-59960635
|
17:59960650-59960672
|
Sequence |
CCAGCCTGCCCAACATGGTGAAA |
AAAAAGTACAAAAGTTAGCCAGG |
Strand |
- |
+ |
Off-target summary |
{0: 1012, 1: 109077, 2: 182407, 3: 160051, 4: 147832} |
{0: 19, 1: 1006, 2: 17962, 3: 112649, 4: 162974} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|