ID: 1149894198_1149894211

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1149894198 1149894211
Species Human (GRCh38) Human (GRCh38)
Location 17:60416444-60416466 17:60416494-60416516
Sequence CCCACAACCCCCTCACCTGCCAG GATTAAAAAAAATGTGGTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 446} {0: 1, 1: 0, 2: 10, 3: 71, 4: 688}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!