ID: 1149936104_1149936110

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1149936104 1149936110
Species Human (GRCh38) Human (GRCh38)
Location 17:60808859-60808881 17:60808912-60808934
Sequence CCTCATGGAGAAGGAGCAGCATA AGCAGATGAGAAGGACTGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 211} {0: 1, 1: 0, 2: 3, 3: 22, 4: 272}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!