ID: 1149957667_1149957675

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1149957667 1149957675
Species Human (GRCh38) Human (GRCh38)
Location 17:61070706-61070728 17:61070743-61070765
Sequence CCCACAGATAATTTATCCTGTCT CTGTATTTACACAGGCAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 202} {0: 1, 1: 0, 2: 0, 3: 15, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!