ID: 1149970540_1149970544

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1149970540 1149970544
Species Human (GRCh38) Human (GRCh38)
Location 17:61213876-61213898 17:61213911-61213933
Sequence CCTTTTGTATTTGTCCCAGGGTA CTATAGAAATGTAGTGCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 278} {0: 1, 1: 0, 2: 0, 3: 12, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!