ID: 1149983933_1149983939

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1149983933 1149983939
Species Human (GRCh38) Human (GRCh38)
Location 17:61333001-61333023 17:61333045-61333067
Sequence CCTGACTCTGAGTTCAGTAACCT AAACCTACACTGCTGCAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 187} {0: 1, 1: 0, 2: 1, 3: 20, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!