ID: 1149986611_1149986617

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1149986611 1149986617
Species Human (GRCh38) Human (GRCh38)
Location 17:61352515-61352537 17:61352532-61352554
Sequence CCTGGTTGGCCTCGGTGGAGTAG GAGTAGAAGTGGAGGGAAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 147} {0: 1, 1: 0, 2: 9, 3: 108, 4: 1033}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!