ID: 1150030569_1150030575

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1150030569 1150030575
Species Human (GRCh38) Human (GRCh38)
Location 17:61730115-61730137 17:61730162-61730184
Sequence CCTACAGTTACAAAGTATAAACT CTTTAATCCTAGGGAAAAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 289} {0: 1, 1: 0, 2: 1, 3: 17, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!