ID: 1150060226_1150060230

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1150060226 1150060230
Species Human (GRCh38) Human (GRCh38)
Location 17:62061630-62061652 17:62061670-62061692
Sequence CCACTTAACGATTAAAATAACTC CAATGAAAGAAAAAGGAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 125} {0: 1, 1: 0, 2: 10, 3: 166, 4: 1382}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!