ID: 1150069592_1150069600

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1150069592 1150069600
Species Human (GRCh38) Human (GRCh38)
Location 17:62139762-62139784 17:62139814-62139836
Sequence CCGCATAGGACAGCAGGTCCGGG CACATACACCAGCTCCTTGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 89} {0: 1, 1: 1, 2: 0, 3: 9, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!