ID: 1150119344_1150119346

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1150119344 1150119346
Species Human (GRCh38) Human (GRCh38)
Location 17:62586867-62586889 17:62586907-62586929
Sequence CCTAGGGAGCTGCTGGTGGGCTG ATTTCCTTCTAGAAGAGACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 413} {0: 1, 1: 0, 2: 0, 3: 20, 4: 348}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!