ID: 1150266748_1150266756

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1150266748 1150266756
Species Human (GRCh38) Human (GRCh38)
Location 17:63837218-63837240 17:63837244-63837266
Sequence CCATCTTCCTCCTCTTTAACCTG AGGACAGAAACCCACTTAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 87, 4: 757} {0: 1, 1: 0, 2: 1, 3: 16, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!