ID: 1150285498_1150285503

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1150285498 1150285503
Species Human (GRCh38) Human (GRCh38)
Location 17:63951621-63951643 17:63951634-63951656
Sequence CCTCCTCGGGCGGCTCCTTCTTC CTCCTTCTTCTCATCCTCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 216} {0: 1, 1: 0, 2: 3, 3: 36, 4: 413}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!