ID: 1150285498_1150285508

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1150285498 1150285508
Species Human (GRCh38) Human (GRCh38)
Location 17:63951621-63951643 17:63951664-63951686
Sequence CCTCCTCGGGCGGCTCCTTCTTC CCCCGCCTCTCCAGCCTCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 216} {0: 1, 1: 0, 2: 9, 3: 83, 4: 829}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!