ID: 1150336473_1150336488

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1150336473 1150336488
Species Human (GRCh38) Human (GRCh38)
Location 17:64334222-64334244 17:64334257-64334279
Sequence CCCCGGGCCAGCGCCCAGCTCTC TGGGGCTGCTCCTTGGAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 23, 4: 310} {0: 1, 1: 0, 2: 7, 3: 43, 4: 350}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!