ID: 1150362123_1150362124

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1150362123 1150362124
Species Human (GRCh38) Human (GRCh38)
Location 17:64545235-64545257 17:64545286-64545308
Sequence CCACTTAGACTAGGTTGAAACAT GAAAAACACAAACATGTAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 348} {0: 1, 1: 0, 2: 1, 3: 110, 4: 972}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!