ID: 1150369615_1150369623

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1150369615 1150369623
Species Human (GRCh38) Human (GRCh38)
Location 17:64625665-64625687 17:64625713-64625735
Sequence CCTAGAGGGCCTGTTAAAATACA CTAATTCAGTAGGTCTATATGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 48, 3: 248, 4: 794} {0: 1, 1: 0, 2: 7, 3: 79, 4: 471}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!