ID: 1150435594_1150435601

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1150435594 1150435601
Species Human (GRCh38) Human (GRCh38)
Location 17:65151936-65151958 17:65151973-65151995
Sequence CCAGCAGCAAACAACAACAGAAA GAGCTTGCTTTCCAGGAGCTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 57, 4: 730} {0: 1, 1: 0, 2: 0, 3: 42, 4: 322}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!