ID: 1150488919_1150488928

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1150488919 1150488928
Species Human (GRCh38) Human (GRCh38)
Location 17:65561355-65561377 17:65561382-65561404
Sequence CCCGCGCCCACGCCGCGGCTCGG ACCTCGCCCCCTGTAAGAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 260} {0: 1, 1: 0, 2: 1, 3: 2, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!