ID: 1150498539_1150498544

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1150498539 1150498544
Species Human (GRCh38) Human (GRCh38)
Location 17:65628214-65628236 17:65628253-65628275
Sequence CCCATTTCTATTTCAGCAGCTTC AATGCAATAAATAAAAATACTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 27, 4: 336} {0: 1, 1: 1, 2: 11, 3: 137, 4: 1541}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!