ID: 1150503222_1150503232

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1150503222 1150503232
Species Human (GRCh38) Human (GRCh38)
Location 17:65671248-65671270 17:65671282-65671304
Sequence CCTGACTACACTTTAAGAGCTCC TTGGGAGGTAGCATCCATAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 73} {0: 1, 1: 0, 2: 0, 3: 7, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!