ID: 1150562846_1150562853

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1150562846 1150562853
Species Human (GRCh38) Human (GRCh38)
Location 17:66309788-66309810 17:66309809-66309831
Sequence CCCACTTTTTTTTTCCCCCGTCA CAGAGAAAGGAGAAGAAGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 377} {0: 1, 1: 0, 2: 10, 3: 138, 4: 1217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!