ID: 1150602838_1150602848

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1150602838 1150602848
Species Human (GRCh38) Human (GRCh38)
Location 17:66665432-66665454 17:66665458-66665480
Sequence CCCTGCACAGTGGAGATGCCCTG AGGGAGCATCGCTGGGCTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 241} {0: 1, 1: 0, 2: 1, 3: 13, 4: 223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!