ID: 1150612820_1150612837

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1150612820 1150612837
Species Human (GRCh38) Human (GRCh38)
Location 17:66747890-66747912 17:66747937-66747959
Sequence CCCCGAGTGCTGGGCACTGTTCC AGAGGAGCCCAGAGGAGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 147} {0: 1, 1: 2, 2: 10, 3: 91, 4: 822}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!