ID: 1150612831_1150612838

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1150612831 1150612838
Species Human (GRCh38) Human (GRCh38)
Location 17:66747911-66747933 17:66747938-66747960
Sequence CCAGGCCGGGGGGTGCCGGGCCA GAGGAGCCCAGAGGAGAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 327} {0: 1, 1: 0, 2: 6, 3: 71, 4: 567}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!