ID: 1150615446_1150615450

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1150615446 1150615450
Species Human (GRCh38) Human (GRCh38)
Location 17:66767303-66767325 17:66767349-66767371
Sequence CCTGCTGTATGTTGTTTTGCTTA CTGCTGGTACGGAGTGAAGACGG
Strand - +
Off-target summary {0: 4, 1: 9, 2: 19, 3: 63, 4: 518} {0: 1, 1: 0, 2: 0, 3: 9, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!