ID: 1150626365_1150626367

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1150626365 1150626367
Species Human (GRCh38) Human (GRCh38)
Location 17:66843768-66843790 17:66843783-66843805
Sequence CCTATCTGGAAAGAAGCCAGCTG GCCAGCTGTCAGCCTGGTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 270} {0: 1, 1: 0, 2: 1, 3: 35, 4: 270}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!