ID: 1150651453_1150651456

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1150651453 1150651456
Species Human (GRCh38) Human (GRCh38)
Location 17:67012976-67012998 17:67012995-67013017
Sequence CCTCTGACATGCTTTTCTCCAGG CAGGATTCCCTTAATGACGATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 17, 4: 262} {0: 1, 1: 0, 2: 0, 3: 4, 4: 47}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!