ID: 1150723016_1150723028

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1150723016 1150723028
Species Human (GRCh38) Human (GRCh38)
Location 17:67629382-67629404 17:67629424-67629446
Sequence CCTGCCTCAGGCTCCCAAGTAGC CAACATGCCCAGTAGGGACGGGG
Strand - +
Off-target summary {0: 651, 1: 79770, 2: 181773, 3: 219919, 4: 222644} {0: 1, 1: 0, 2: 1, 3: 7, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!