ID: 1150723022_1150723028

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1150723022 1150723028
Species Human (GRCh38) Human (GRCh38)
Location 17:67629396-67629418 17:67629424-67629446
Sequence CCAAGTAGCTGGGATTACAGGCA CAACATGCCCAGTAGGGACGGGG
Strand - +
Off-target summary {0: 52453, 1: 101789, 2: 153905, 3: 227834, 4: 315316} {0: 1, 1: 0, 2: 1, 3: 7, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!