ID: 1150753880_1150753886

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1150753880 1150753886
Species Human (GRCh38) Human (GRCh38)
Location 17:67892852-67892874 17:67892903-67892925
Sequence CCACTGTTTATCTGATAGTCCAC ACTATTTTGAAGTATCCATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 120} {0: 2, 1: 0, 2: 2, 3: 17, 4: 236}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!