ID: 1150797189_1150797199

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1150797189 1150797199
Species Human (GRCh38) Human (GRCh38)
Location 17:68247913-68247935 17:68247943-68247965
Sequence CCAGGCGGCCGCACGCTCAGGGG TGGGTGGGTCGTGAGTTGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 123} {0: 1, 1: 0, 2: 10, 3: 29, 4: 456}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!