ID: 1150831420_1150831426

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1150831420 1150831426
Species Human (GRCh38) Human (GRCh38)
Location 17:68523306-68523328 17:68523346-68523368
Sequence CCAGGCTATTTTGAGTTATGCTG CAGAATTGTCCTGGCACTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 83, 4: 443} {0: 1, 1: 0, 2: 1, 3: 29, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!