ID: 1150840379_1150840398

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1150840379 1150840398
Species Human (GRCh38) Human (GRCh38)
Location 17:68601010-68601032 17:68601049-68601071
Sequence CCGGCGCCGGCTGCCACCGCGGG CGGGGGGCGACCGCGGAGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 251} {0: 1, 1: 0, 2: 6, 3: 23, 4: 299}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!