ID: 1151188843_1151188849

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1151188843 1151188849
Species Human (GRCh38) Human (GRCh38)
Location 17:72383076-72383098 17:72383096-72383118
Sequence CCCCCAGGAGTGGGTCAAGGATG ATGCGCAGACGCAGCTCCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 187} {0: 1, 1: 0, 2: 0, 3: 3, 4: 55}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!