ID: 1151227005_1151227015

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1151227005 1151227015
Species Human (GRCh38) Human (GRCh38)
Location 17:72655212-72655234 17:72655252-72655274
Sequence CCTCCACACACCCGTGCACACGC CCCTCGCCCCGCTGCTTGTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 85, 4: 669} {0: 1, 1: 0, 2: 1, 3: 2, 4: 77}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!