ID: 1151243433_1151243443

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1151243433 1151243443
Species Human (GRCh38) Human (GRCh38)
Location 17:72776004-72776026 17:72776031-72776053
Sequence CCTGCCACATGTTCCCTCTCCCT CAGGCTGGTCCAGGAAGAATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 57, 4: 536} {0: 1, 1: 0, 2: 2, 3: 23, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!