ID: 1151248739_1151248743

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1151248739 1151248743
Species Human (GRCh38) Human (GRCh38)
Location 17:72817151-72817173 17:72817186-72817208
Sequence CCAATGGTTCTGAAGCCTGTACA TCAACATGTGCTTCTGATGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 35, 3: 93, 4: 248} {0: 1, 1: 1, 2: 35, 3: 180, 4: 753}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!