ID: 1151249321_1151249331

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1151249321 1151249331
Species Human (GRCh38) Human (GRCh38)
Location 17:72821380-72821402 17:72821420-72821442
Sequence CCTGTAGTCCCAGCTACTCAGGA CGATTGAACTCAGGAGGCGGAGG
Strand - +
Off-target summary {0: 40895, 1: 157395, 2: 217955, 3: 208005, 4: 130380} {0: 2, 1: 476, 2: 10637, 3: 52977, 4: 114797}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!