ID: 1151260611_1151260618

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1151260611 1151260618
Species Human (GRCh38) Human (GRCh38)
Location 17:72913093-72913115 17:72913141-72913163
Sequence CCAGAATATAATATGCCATATTA TAGATAGGAGGTAAGAGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 325} {0: 1, 1: 0, 2: 1, 3: 16, 4: 314}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!