|
Left Crispr |
Right Crispr |
| Crispr ID |
1151274656 |
1151274662 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:73024964-73024986
|
17:73025001-73025023
|
| Sequence |
CCTCGGCCTCCCAAAATGCTGAG |
CTACCGCGCCTGGCCAAAACTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 271, 1: 11389, 2: 148935, 3: 285332, 4: 216067} |
{0: 1, 1: 1, 2: 35, 3: 237, 4: 1060} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|