ID: 1151325971_1151325983

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1151325971 1151325983
Species Human (GRCh38) Human (GRCh38)
Location 17:73379945-73379967 17:73379970-73379992
Sequence CCATCCACCAACTCTTTACACAG GGGCTCAGCTCCAGGGGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 212} {0: 1, 1: 0, 2: 5, 3: 44, 4: 444}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!