ID: 1151331308_1151331313

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1151331308 1151331313
Species Human (GRCh38) Human (GRCh38)
Location 17:73410849-73410871 17:73410874-73410896
Sequence CCTCCTCTTGCTCTGGGTCACCA GGCCACTGCCCTAATTGTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 286} {0: 1, 1: 0, 2: 1, 3: 12, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!