ID: 1151349673_1151349680

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1151349673 1151349680
Species Human (GRCh38) Human (GRCh38)
Location 17:73524396-73524418 17:73524413-73524435
Sequence CCCAGAACTAAAATTCCTGCCCT TGCCCTTCCCCTGGTGGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 215} {0: 1, 1: 0, 2: 3, 3: 25, 4: 306}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!