ID: 1151351253_1151351261

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1151351253 1151351261
Species Human (GRCh38) Human (GRCh38)
Location 17:73533444-73533466 17:73533478-73533500
Sequence CCAGCAAGAGTGCAAACAGTCTG GTCCCTGGACACAGGCCCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 134} {0: 1, 1: 3, 2: 14, 3: 87, 4: 452}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!