ID: 1151459250_1151459257

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1151459250 1151459257
Species Human (GRCh38) Human (GRCh38)
Location 17:74245062-74245084 17:74245080-74245102
Sequence CCTAACCACACTCACACCTCGTC TCGTCCAGTGACTTGGGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 159} {0: 1, 1: 0, 2: 1, 3: 10, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!